Contig480Fb, Contig480Fb (genetic_marker) Vaccinium corymbosum

Marker Overview
NameContig480Fb
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1Contig480Fb.forward primer: GATGATGTGGGGCCTAAGAA
Primer 2Contig480Fb.reverse primer: CGCATTCGACTCAATGTTGT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG03N/A3.7Contig480FbView
2Cranberry-Crimson_Queen-2007LG3N/A7.8Contig480FbView
3Cranberry-CNJ02-1-2007LG3N/A9.84Contig480FbView
4Cranberry-CNJ02-1-2017LG03N/A6.1Contig480FbView
5Cranberry-Composite_map-F1LG03N/A82.61contig480FbView
6Cranberry-Crimson_Queen-F1LG03N/A80.09contig480FbView
7Cranberry-GH1/35-F1LG03N/A83.51contig480FbView
8Cranberry-BB/CQ-F1LG07N/A3.39Contig480FbView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerContig480Fb.forward primerVaccinium corymbosumprimer
reverse primerContig480Fb.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Contig480FbContig480FbVaccinium corymbosummarker_locus
contig480Fbcontig480Fb-82.61Vaccinium corymbosummarker_locus
contig480Fbcontig480Fb-80.09Vaccinium corymbosummarker_locus
contig480Fbcontig480Fb-83.51Vaccinium corymbosummarker_locus
Contig480FbContig480Fb-3.393Vaccinium corymbosummarker_locus