Contig600, Contig600 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameContig600
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1Contig600.forward primer: GCCAAAGCTGGAGAGAGAAA
Primer 2Contig600.reverse primer: GACTTCAGCAGCCAACATCA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG4N/A81.83Contig600View
2Blueberry-W85-23-2017LG04N/A61.6Contig600View
3Cranberry-Crimson_Queen-2017LG04N/A47Contig600View
4Cranberry-Mullica_Queen-2007LG4N/A86.2Contig600View
5Blueberry-F1#10_x_W85-23-F1-2017LG04N/A64.2Contig600View
6Cranberry-Mullica_Queen-2017LG04N/A89.5Contig600View
7Blueberry-F1#10-2017LG04N/A75.3Contig600View
8Cranberry-CNJ02-1-2017LG04N/A83.7Contig600View
9Cranberry-Crimson_Queen-2007LG4N/A72.6Contig600View
10Cranberry-Composite_map-F1LG04N/A69.82contig600View
11Cranberry-Crimson_Queen-F1LG04N/A70.29contig600View
12Cranberry-Mullica_Queen_1-F1LG04N/A98.49contig600View
13Cranberry-Stevens-F1LG04N/A46.56contig600View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerContig600.forward primerVaccinium corymbosumprimer
reverse primerContig600.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Contig600Contig600Vaccinium corymbosummarker_locus
contig600contig600-69.82Vaccinium corymbosummarker_locus
contig600contig600-70.29Vaccinium corymbosummarker_locus
contig600contig600-98.49Vaccinium corymbosummarker_locus
contig600contig600-46.56Vaccinium corymbosummarker_locus