418931_1_K63, 418931_1_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name418931_1_K63
Genbank IDKP279191
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)15
Primer 1418931_1_K63.forward primer: ATTAGCTCAGTTCCCAGTAACA
Primer 2418931_1_K63.reverse primer: CTTCTTTCTCTTTCTCCTTCCT
Max Length177
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10_x_W85-23-F1-2017LG10N/A4.4418931_1_K63View
2Blueberry-W85-23-2017LG10N/A1.2418931_1_K63View
3Cranberry-Mullica_Queen-2017LG10N/A0418931_1_K63View
4Blueberry-F1#10-2017LG10N/A12.3418931_1_K63View
5Cranberry-Crimson_Queen-2017LG10N/A7.8418931_1_K63View
6Cranberry-CNJ02-1-2007LG10N/A8.28418931_1_K63View
7Cranberry-Mullica_Queen-2007LG10N/A10.8418931_1_K63View
8Cranberry-CNJ02-1-2017LG10N/A4418931_1_K63View
9Cranberry-Crimson_Queen-2007LG10N/A6.8418931_1_K63View
10Cranberry-Composite_map-F1LG10N/A72.58418931_1_K63View
11Cranberry-Crimson_Queen-F1LG10N/A69.14418931_1_K63View
12Cranberry-Mullica_Queen_1-F1LG10N/A83.67418931_1_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279191
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer418931_1_K63.forward primerVaccinium macrocarponprimer
reverse primer418931_1_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
418931_1_K63418931_1_K63Vaccinium macrocarponmarker_locus
418931_1_K63418931_1_K63-72.58Vaccinium macrocarponmarker_locus
418931_1_K63418931_1_K63-69.14Vaccinium macrocarponmarker_locus
418931_1_K63418931_1_K63-83.67Vaccinium macrocarponmarker_locus