Contig652, Contig652 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Contig652
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Contig652.forward primer: AAAACTGTCGGCAGATCCTC
Primer 2	Contig652.reverse primer: GGGATACCAATGTGGGTCAG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr01	supercontig	Vcev1_p0.Chr01:43183204..43183430 .
VaccDscaff1	supercontig	VaccDscaff1:34422301..34422530 .
scaffold00262	supercontig	scaffold00262:68178..68403 .
chr1_H1	supercontig	chr1_H1:38056215..38056446 .
Vmac_chr06	supercontig	Vmac_chr06:30521023..30521253 .
chr6	supercontig	chr6:9164005..9164249 .
Chr01_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr01_Vaccinium_vitis-idaea_ssp_minus:10938434..10938659 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG6	N/A	21.08	Contig652	View
2	Cranberry-Crimson_Queen-2007	LG6	N/A	16.4	Contig652	View
3	Cranberry-Mullica_Queen-2007	LG6	N/A	30.9	Contig652	View
4	Blueberry-F1#10_x_W85-23-F1-2017	LG06	N/A	24.1	Contig652	View
5	Blueberry-F1#10-2017	LG06	N/A	28.4	Contig652	View
6	Cranberry-CNJ02-1-2017	LG06	N/A	1.5	Contig652	View
7	Cranberry-Crimson_Queen-2017	LG06	N/A	2.7	Contig652	View
8	Cranberry-Mullica_Queen-2017	LG06	N/A	0.5	Contig652	View
9	Cranberry-Composite_map-F1	LG06	N/A	80.75	contig652	View
10	Cranberry-Crimson_Queen-F1	LG06	N/A	77.09	contig652	View
11	Cranberry-Mullica_Queen_1-F1	LG06	N/A	97.63	contig652	View
12	Cranberry-BB/CQ-F1	LG05	N/A	70.41	Contig652	View
13	Cranberry-BB/CQ-F1	LG05	N/A	18.17	Contig652	View