ct130570, ct130570 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect130570
Genbank IDKP279121
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TTC)6
Primer 1ct130570.forward primer: GTTCACAATCTGCATCTCCT
Primer 2ct130570.reverse primer: ACGTAATAGATCAAGAACAGGG
Max Length200
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG02N/A72.1ct130570View
2Cranberry-Mullica_Queen-2007LG2N/A79.2ct130570View
3Cranberry-CNJ02-1-2017LG02N/A66.7ct130570View
4Cranberry-CNJ02-1-2007LG2N/A70.75ct130570View
5Cranberry-Composite_map-F1LG02N/A29.37ct130570View
6Cranberry-Mullica_Queen_1-F1LG02N/A37.13ct130570View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279121
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct130570.forward primerVaccinium macrocarponprimer
reverse primerct130570.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct130570ct130570Vaccinium macrocarponmarker_locus
ct130570ct130570-29.37Vaccinium macrocarponmarker_locus
ct130570ct130570-37.13Vaccinium macrocarponmarker_locus