ct130570, ct130570 (genetic_marker) Vaccinium macrocarpon

Marker Overview


Name	ct130570
Genbank ID	KP279121
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TTC)6
Primer 1	ct130570.forward primer: GTTCACAATCTGCATCTCCT
Primer 2	ct130570.reverse primer: ACGTAATAGATCAAGAACAGGG
Max Length	200
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Mullica_Queen-2017	LG02	N/A	72.1	ct130570	View
2	Cranberry-Mullica_Queen-2007	LG2	N/A	79.2	ct130570	View
3	Cranberry-CNJ02-1-2017	LG02	N/A	66.7	ct130570	View
4	Cranberry-CNJ02-1-2007	LG2	N/A	70.75	ct130570	View
5	Cranberry-Composite_map-F1	LG02	N/A	29.37	ct130570	View
6	Cranberry-Mullica_Queen_1-F1	LG02	N/A	37.13	ct130570	View

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279121

Relationships

This genetic_marker is adjacent to the following primer feature(s):


Feature Name	Unique Name	Species	Type
forward primer	ct130570.forward primer	Vaccinium macrocarpon	primer
reverse primer	ct130570.reverse primer	Vaccinium macrocarpon	primer

The following marker_locus feature(s) are an instance of this genetic_marker:


Feature Name	Unique Name	Species	Type
ct130570	ct130570	Vaccinium macrocarpon	marker_locus
ct130570	ct130570-29.37	Vaccinium macrocarpon	marker_locus
ct130570	ct130570-37.13	Vaccinium macrocarpon	marker_locus