Contig704, Contig704 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Contig704
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Contig704.forward primer: AAATGGCAGGAATCATGGAC
Primer 2	Contig704.reverse primer: CTGTTGATCAGCACCACCAC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr11	supercontig	Vcev1_p0.Chr11:42441817..42442085 .
VaccDscaff33	supercontig	VaccDscaff33:10400672..10400940 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG2	N/A	19.09	Contig704	View
2	Cranberry-Mullica_Queen-2007	LG2	N/A	22.6	Contig704	View
3	Cranberry-CNJ02-1-2017	LG02	N/A	16.4	Contig704	View
4	Cranberry-Mullica_Queen-2017	LG02	N/A	17.9	Contig704	View
5	Cranberry-Composite_map-F1	LG02	N/A	85.98	contig704	View
6	Cranberry-Mullica_Queen_1-F1	LG02	N/A	95.93	contig704	View