419957_K63, 419957_K63 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	419957_K63
Genbank ID	KP279268
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)14
Primer 1	419957_K63.forward primer: AGACTCACCTCTCTTTCTTGTG
Primer 2	419957_K63.reverse primer: GACTATCTTTCGGTTGACACTT
Publication	[view all]

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279268

Relationships

This genetic_marker is adjacent to the following primer feature(s):


Feature Name	Unique Name	Species	Type
forward primer	419957_K63.forward primer	Vaccinium macrocarpon	primer
reverse primer	419957_K63.reverse primer	Vaccinium macrocarpon	primer