419957_K63, 419957_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name419957_K63
Genbank IDKP279268
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)14
Primer 1419957_K63.forward primer: AGACTCACCTCTCTTTCTTGTG
Primer 2419957_K63.reverse primer: GACTATCTTTCGGTTGACACTT
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279268
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer419957_K63.forward primerVaccinium macrocarponprimer
reverse primer419957_K63.reverse primerVaccinium macrocarponprimer