ct134336, ct134336 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect134336
Genbank IDKP279123
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TCC)6
Primer 1ct134336.forward primer: GAACACTCCTTCTCTAGCTCTG
Primer 2ct134336.reverse primer: CTTTTTAGTCTCCGACAATCTC
Max Length201
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279123
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG8N/A36.2ct134336View
2Cranberry-Crimson_Queen-2007LG8N/A33.5ct134336View
3Cranberry-CNJ02-1-2017LG08N/A35.1ct134336View
4Cranberry-Crimson_Queen-2017LG08N/A30.4ct134336View
5Cranberry-Composite_map-F1LG08N/A52.33ct134336View
6Cranberry-Crimson_Queen-F1LG08N/A38.79ct134336View