ct134336, ct134336 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect134336
Genbank IDKP279123
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TCC)6
Primer 1ct134336.forward primer: GAACACTCCTTCTCTAGCTCTG
Primer 2ct134336.reverse primer: CTTTTTAGTCTCCGACAATCTC
Max Length201
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG8N/A33.5ct134336View
2Cranberry-CNJ02-1-2007LG8N/A36.2ct134336View
3Cranberry-CNJ02-1-2017LG08N/A35.1ct134336View
4Cranberry-Crimson_Queen-2017LG08N/A30.4ct134336View
5Cranberry-Composite_map-F1LG08N/A52.33ct134336View
6Cranberry-Crimson_Queen-F1LG08N/A38.79ct134336View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279123
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct134336.forward primerVaccinium macrocarponprimer
reverse primerct134336.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct134336ct134336Vaccinium macrocarponmarker_locus
ct134336ct134336-52.33Vaccinium macrocarponmarker_locus
ct134336ct134336-38.79Vaccinium macrocarponmarker_locus