42710_K70, 42710_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name42710_K70
Genbank IDKP279194
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)16
Primer 142710_K70.forward primer: GTTACACACACACCCACAGA
Primer 242710_K70.reverse primer: GAGAGAGGACTAGGTCGTACAG
Max Length203
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG3N/A76.142710_K70View
2Cranberry-CNJ02-1-2007LG3N/A84.9942710_K70View
3Cranberry-Mullica_Queen-2007LG3N/A96.142710_K70View
4Cranberry-CNJ02-1-2017LG03N/A79.342710_K70View
5Cranberry-Crimson_Queen-2017LG03N/A70.942710_K70View
6Cranberry-Mullica_Queen-2017LG03N/A87.342710_K70View
7Cranberry-Composite_map-F1LG03N/A17.5242710_K70View
8Cranberry-Crimson_Queen-F1LG03N/A14.942710_K70View
9Cranberry-Mullica_Queen_1-F1LG03N/A24.5142710_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279194
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer42710_K70.forward primerVaccinium macrocarponprimer
reverse primer42710_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
42710_K7042710_K70Vaccinium macrocarponmarker_locus
42710_K7042710_K70-17.52Vaccinium macrocarponmarker_locus
42710_K7042710_K70-14.9Vaccinium macrocarponmarker_locus
42710_K7042710_K70-24.51Vaccinium macrocarponmarker_locus