ct136900, ct136900 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	ct136900
Genbank ID	KP279154
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AAAAGG)4
Primer 1	ct136900.forward primer: ACGATATGAGAGAAGAAGAGGA
Primer 2	ct136900.reverse primer: CTCTAGTGCATACCAGCACTT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279154

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr11	supercontig	Vmac_chr11:40716080..40716267 .
chr11	supercontig	chr11:38884989..38885176 .
Chr04	supercontig	Chr04:38189170..38189352 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.