ct139597, ct139597 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	ct139597
Genbank ID	KP279155
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)11
Primer 1	ct139597.forward primer: CTTATAGGCAATGCACATAcAC
Primer 2	ct139597.reverse primer: GTAACTAATGGGGCTGAACTT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279155

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:4409750..4409957 .
chr8	supercontig	chr8:4555140..4555347 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.