47166_K70, 47166_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name47166_K70
Genbank IDKP279195
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)15
Primer 147166_K70.forward primer: TATTGAGAGTGTGAGACCGTT
Primer 247166_K70.reverse primer: TGGTAAGTATCGTAGGTCCAAT
Max Length315
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG05N/A80.447166_K70View
2Cranberry-CNJ02-1-2017LG05N/A75.647166_K70View
3Cranberry-Mullica_Queen-2007LG5N/A105.447166_K70View
4Cranberry-CNJ02-1-2007LG5N/A97.9447166_K70View
5Cranberry-Composite_map-F1LG05N/A88.3147166_K70View
6Cranberry-Mullica_Queen_1-F1LG05N/A100.8247166_K70View
7Cranberry-Mullica_Queen_2-F1LG05N/A84.1547166_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279195
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer47166_K70.forward primerVaccinium macrocarponprimer
reverse primer47166_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
47166_K7047166_K70Vaccinium macrocarponmarker_locus
47166_K7047166_K70-88.31Vaccinium macrocarponmarker_locus
47166_K7047166_K70-100.82Vaccinium macrocarponmarker_locus
47166_K7047166_K70-84.15Vaccinium macrocarponmarker_locus