ct160768, ct160768 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	ct160768
Genbank ID	KP279143
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GTTTG)4
Primer 1	ct160768.forward primer: GTGTGGTATGTTGGATGTAAAC
Primer 2	ct160768.reverse primer: TAAGGGGATTTCATTGGG
Max Length	144
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279143

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr01	supercontig	Vmac_chr01:18552488..18552605 .
chr1	supercontig	chr1:26362685..26362802 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.