ct144370, ct144370 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect144370
Genbank IDKP279127
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)11
Primer 1ct144370.forward primer: GTAGGAAAAGTTTGAACCGTC
Primer 2ct144370.reverse primer: TCAAAGGTTTCACGTTTCTC
Max Length237
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG5N/A7.7ct144370View
2Cranberry-CNJ02-1-2007LG5N/A9.21ct144370View
3Cranberry-Crimson_Queen-2017LG05N/A6.3ct144370View
4Cranberry-CNJ02-1-2017LG05N/A8.4ct144370View
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG5N/A57.96ct144370View
6Cranberry-Mullica_Queen-2017LG05N/A11.5ct144370View
7Cranberry-Mullica_Queen-2007LG5N/A12ct144370View
8Cranberry-[BG//BL/BN]95-F1LG05N/A9.77ct144370View
9Cranberry-Composite_map-F1LG05N/A9.77ct144370View
10Cranberry-Crimson_Queen-F1LG05N/A5.36ct144370View
11Cranberry-GH1/35-F1LG05N/A12.51ct144370View
12Cranberry-Mullica_Queen_1-F1LG05N/A9.54ct144370View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279127
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct144370.forward primerVaccinium macrocarponprimer
reverse primerct144370.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct144370ct144370Vaccinium macrocarponmarker_locus
ct144370ct144370-9.77Vaccinium macrocarponmarker_locus
ct144370ct144370-5.36Vaccinium macrocarponmarker_locus
ct144370ct144370-12.51Vaccinium macrocarponmarker_locus
ct144370ct144370-9.54Vaccinium macrocarponmarker_locus