ct144558, ct144558 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect144558
Genbank IDKP279128
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)9
Primer 1ct144558.forward primer: TCATTACCCCTAACCTCTAAAC
Primer 2ct144558.reverse primer: ATTCGACTAGAGTGGAGAGAAA
Max Length227
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG9N/A8.83ct144558View
2Cranberry-CNJ02-1-2017LG09N/A4.3ct144558View
3Cranberry-Crimson_Queen-2007LG9N/A9.8ct144558View
4Cranberry-Crimson_Queen-2017LG09N/A4.6ct144558View
5Cranberry-Composite_map-F1LG09N/A87.09ct144558View
6Cranberry-Crimson_Queen-F1LG09N/A66.78ct144558View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279128
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct144558.forward primerVaccinium macrocarponprimer
reverse primerct144558.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct144558ct144558Vaccinium macrocarponmarker_locus
ct144558ct144558-87.09Vaccinium macrocarponmarker_locus
ct144558ct144558-66.78Vaccinium macrocarponmarker_locus