60699_K70, 60699_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name60699_K70
Genbank IDKP279196
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)19
Primer 160699_K70.forward primer: CTTCTCACTGTATTTCTTCGAG
Primer 260699_K70.reverse primer: GGCTACTTTGTTAGGGTAGATT
Max Length304
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG10N/A10.3360699_K70View
2Cranberry-Mullica_Queen-2007LG10N/A14.260699_K70View
3Cranberry-Mullica_Queen-2017LG10N/A1.860699_K70View
4Cranberry-Crimson_Queen-2017LG10N/A7.860699_K70View
5Cranberry-CNJ02-1-2017LG10N/A4.860699_K70View
6Cranberry-Crimson_Queen-2007LG10N/A7.760699_K70View
7Cranberry-Composite_map-F1LG10N/A71.3960699_K70View
8Cranberry-Crimson_Queen-F1LG10N/A67.9560699_K70View
9Cranberry-Mullica_Queen_1-F1LG10N/A78.3160699_K70View
10Cranberry-Mullica_Queen_2-F1LG10N/A70.9260699_K70View
11Cranberry-Stevens-F1LG10N/A73.6160699_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279196
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer60699_K70.forward primerVaccinium macrocarponprimer
reverse primer60699_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
60699_K7060699_K70Vaccinium macrocarponmarker_locus
60699_K7060699_K70-71.39Vaccinium macrocarponmarker_locus
60699_K7060699_K70-67.95Vaccinium macrocarponmarker_locus
60699_K7060699_K70-78.31Vaccinium macrocarponmarker_locus
60699_K7060699_K70-70.92Vaccinium macrocarponmarker_locus
60699_K7060699_K70-73.61Vaccinium macrocarponmarker_locus