ct188529, ct188529 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect188529
Genbank IDKP279148
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)10
Primer 1ct188529.forward primer: TTGCAGAATCAATAGTACCTCC
Primer 2ct188529.reverse primer: CCTCATTAGCTATGGTGAAAC
Max Length232
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG6N/A56.7ct188529View
2Cranberry-Crimson_Queen-2017LG06N/A51ct188529View
3Cranberry-CNJ02-1-2017LG06N/A58.2ct188529View
4Cranberry-Mullica_Queen-2017LG06N/A65.9ct188529View
5Cranberry-CNJ02-1-2007LG6N/A64.28ct188529View
6Cranberry-Mullica_Queen-2007LG6N/A76.6ct188529View
7Cranberry-Composite_map-F1LG06N/A34.29ct188529View
8Cranberry-Crimson_Queen-F1LG06N/A29.2ct188529View
9Cranberry-Mullica_Queen_1-F1LG06N/A37.04ct188529View
10Cranberry-BB/CQ-F1LG05N/A28.78ct188529View
11Cranberry-BB/CQ-F1LG05N/A63.33ct188529View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279148
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct188529.forward primerVaccinium macrocarponprimer
reverse primerct188529.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct188529ct188529Vaccinium macrocarponmarker_locus
ct188529ct188529-34.29Vaccinium macrocarponmarker_locus
ct188529ct188529-29.2Vaccinium macrocarponmarker_locus
ct188529ct188529-37.04Vaccinium macrocarponmarker_locus
ct188529ct188529-28.776Vaccinium macrocarponmarker_locus
ct188529ct188529-63.326Vaccinium macrocarponmarker_locus