6ms4e4b, 6ms4e4b (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	6ms4e4b
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	6ms4e4b.forward primer: GGCCAAGGTTCTACCCTTTC
Primer 2	6ms4e4b.reverse primer: CAACTACCCACCACCACCAT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr12_H1	supercontig	chr12_H1:8110161..8110298 .
Vmac_chr07	supercontig	Vmac_chr07:7030568..7030687 .
chr7	supercontig	chr7:6464511..6464628 .
Chr12	supercontig	Chr12:6915536..6915689 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG7	N/A	79.62	6ms4e4b	View
2	Cranberry-Mullica_Queen-2007	LG7	N/A	89.9	6ms4e4b	View
3	Cranberry-Unifiedmap2013	LG3	N/A	84.2	6ms4e4b	View
4	Blueberry-F1#10_x_W85-23-F1-2017	LG07	N/A	77.7	6ms4e4b	View
5	Blueberry-F1#10-2017	LG07	N/A	80	6ms4e4b	View
6	Blueberry-W85-23-2017	LG07	N/A	66.6	6ms4e4b	View
7	Cranberry-CNJ02-1-2017	LG07	N/A	75.3	6ms4e4b	View
8	Cranberry-Mullica_Queen-2017	LG07	N/A	85.2	6ms4e4b	View
9	Cranberry-Composite_map-F1	LG07	N/A	15.75	6ms4e4b	View
10	Cranberry-Mullica_Queen_1-F1	LG07	N/A	20.92	6ms4e4b	View