71002_K63, 71002_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name71002_K63
Genbank IDKP279161
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)16
Primer 171002_K63.forward primer: CTTCAATCCACGAATACCAC
Primer 271002_K63.reverse primer: CAATTATGCAAAGGAGGAAG
Max Length248
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG10N/A31.471002_K63View
2Cranberry-Mullica_Queen-2017LG10N/A38.471002_K63View
3Cranberry-Crimson_Queen-2007LG10N/A29.771002_K63View
4Cranberry-Crimson_Queen-2017LG10N/A28.471002_K63View
5Cranberry-Mullica_Queen-2007LG10N/A49.271002_K63View
6Cranberry-CNJ02-1-2007LG10N/A39.6571002_K63View
7Cranberry-Composite_map-F1LG10N/A45.7571002_K63View
8Cranberry-Crimson_Queen-F1LG10N/A47.771002_K63View
9Cranberry-Mullica_Queen_1-F1LG10N/A47.1371002_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279161
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer71002_K63.forward primerVaccinium macrocarponprimer
reverse primer71002_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
71002_K6371002_K63Vaccinium macrocarponmarker_locus
71002_K6371002_K63-45.75Vaccinium macrocarponmarker_locus
71002_K6371002_K63-47.7Vaccinium macrocarponmarker_locus
71002_K6371002_K63-47.13Vaccinium macrocarponmarker_locus