ct152567, ct152567 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	ct152567
Genbank ID	KP279135
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)13
Primer 1	ct152567.forward primer: GTGGCTTTTCTGATCTTGTT
Primer 2	ct152567.reverse primer: AAAGTACTCTCAATTGGTACGG
Max Length	226
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279135

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr01	supercontig	Vmac_chr01:41334978..41335165 .
chr1	supercontig	chr1:9076167..9076348 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.