ct97791, ct97791 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	ct97791
Genbank ID	KP279150
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AC)10
Primer 1	ct97791.forward primer: GACTTTGTGAGGATAGACCATT
Primer 2	ct97791.reverse primer: ATGTAAGATGTGGaCaTaAgGG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279150

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr10	supercontig	Vmac_chr10:477804..478052 .
chr10	supercontig	chr10:465390..465634 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.