ct153008, ct153008 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect153008
Genbank IDKP279136
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)11
Primer 1ct153008.forward primer: CTTTCCAAGATCTTCATAGGC
Primer 2ct153008.reverse primer: CGACAGTATAATAGCATGGAGA
Max Length266
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG5N/A0.4ct153008ViewN/A
2Blueberry-F1#10-2017LG05N/A0ct153008ViewN/A
3Blueberry-W85-23-2017LG05N/A0ct153008ViewN/A
4Blueberry-F1#10_x_W85-23-F1-2017LG05N/A0.8ct153008ViewN/A
5Cranberry-Crimson_Queen-2017LG05N/A0ct153008ViewN/A
6Cranberry-Composite_map-F1LG05N/A0ct153008ViewN/A
7Cranberry-CNJ02-1-2007LG5N/A0.17ct153008ViewN/A
8Cranberry-CNJ02-1-2017LG05N/A0ct153008ViewN/A
9Cranberry-Mullica_Queen-2007LG5N/A0.1ct153008ViewN/A
10Cranberry-Mullica_Queen_1-F1LG05N/A0ct153008ViewN/A
11Cranberry-Mullica_Queen-2017LG05N/A0ct153008ViewN/A
12Cranberry-GH1/35-F1LG05N/A0ct153008ViewN/A
13Cranberry-Crimson_Queen-F1LG05N/A0ct153008ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279136
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct153008.forward primerVaccinium macrocarponprimer
reverse primerct153008.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct153008ct153008Vaccinium macrocarponmarker_locus