ct154654, ct154654 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect154654
Genbank IDKP279139
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)10
Primer 1ct154654.forward primer: GATTTCTAGTGGGAAATGAAGG
Primer 2ct154654.reverse primer: GGTGTATGTGTGTGATTAAGGA
Max Length171
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG09N/A87.34ct154654View
2Cranberry-Crimson_Queen-F1LG09N/A67.38ct154654View
3Cranberry-Mullica_Queen_1-F1LG09N/A100.76ct154654View
4Cranberry-CNJ02-1-2017LG09N/A2.2ct154654View
5Cranberry-Crimson_Queen-2017LG09N/A4.1ct154654View
6Cranberry-Mullica_Queen-2017LG09N/A0ct154654View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279139
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct154654.forward primerVaccinium macrocarponprimer
reverse primerct154654.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct154654ct154654-87.34Vaccinium macrocarponmarker_locus
ct154654ct154654-67.38Vaccinium macrocarponmarker_locus
ct154654ct154654-100.76Vaccinium macrocarponmarker_locus
ct154654ct154654Vaccinium macrocarponmarker_locus