ct155339, ct155339 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect155339
Genbank IDKP279140
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CCA)6
Primer 1ct155339.forward primer: AAGTTCCTCTGTTACAAGCTCT
Primer 2ct155339.reverse primer: ATGACGAACTCTTCCTCCTTAT
Max Length228
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG03N/A20.3ct155339View
2Cranberry-CNJ02-1-2017LG03N/A22.9ct155339View
3Cranberry-Crimson_Queen-2007LG3N/A23.6ct155339View
4Cranberry-CNJ02-1-2007LG3N/A27.31ct155339View
5Cranberry-Composite_map-F1LG03N/A62.75ct155339View
6Cranberry-Crimson_Queen-F1LG03N/A62.2ct155339View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279140
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct155339.forward primerVaccinium macrocarponprimer
reverse primerct155339.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct155339ct155339Vaccinium macrocarponmarker_locus
ct155339ct155339-62.75Vaccinium macrocarponmarker_locus
ct155339ct155339-62.2Vaccinium macrocarponmarker_locus