ct89348, ct89348 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect89348
Genbank IDKP279100
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CACCT)4
Primer 1ct89348.forward primer: GGCTCAATCTTGTGTAGGTATT
Primer 2ct89348.reverse primer: GAGAAAGTGGAAAGATTGTGTG
Max Length194
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG2N/A62.7ct89348ViewN/A
2Blueberry-F1#10_x_W85-23-F1-2017LG02N/A50.9ct89348ViewN/A
3Blueberry-F1#10-2017LG02N/A13.3ct89348ViewN/A
4Cranberry-CNJ02-1-2017LG02N/A50.6ct89348ViewN/A
5Cranberry-Mullica_Queen-2017LG02N/A53.7ct89348ViewN/A
6Blueberry-W85-23-2017LG02N/A52.3ct89348ViewN/A
7Cranberry-CNJ02-1-2007LG2N/A56.38ct89348ViewN/A
8Cranberry-Composite_map-F1LG02N/A47.79ct89348ViewN/A
9Cranberry-Mullica_Queen_1-F1LG02N/A57.93ct89348ViewN/A
10Cranberry-Mullica_Queen_2-F1LG02N/A61.51ct89348ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279100
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct89348.forward primerVaccinium macrocarponprimer
reverse primerct89348.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct89348ct89348Vaccinium macrocarponmarker_locus
ct89348ct89348-47.79Vaccinium macrocarponmarker_locus
ct89348ct89348-57.93Vaccinium macrocarponmarker_locus
ct89348ct89348-61.51Vaccinium macrocarponmarker_locus