ct89379, ct89379 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	ct89379
Genbank ID	KP279101
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)10
Primer 1	ct89379.forward primer: ATGAAGAGCTTGAATGGCTA
Primer 2	ct89379.reverse primer: ACACTTTACACCACAACTCGTA
Max Length	183
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279101

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr8	supercontig	chr8:34447899..34448052 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG8	N/A	0	ct89379	View
2	Cranberry-CNJ02-1-2007	LG8	N/A	2.7	ct89379	View
3	Cranberry-Crimson_Queen-2007	LG8	N/A	3.2	ct89379	View
4	Cranberry-Mullica_Queen-2007	LG8	N/A	1.7	ct89379	View
5	Blueberry-F1#10_x_W85-23-F1-2017	LG08	N/A	1.4	ct89379	View
6	Blueberry-F1#10-2017	LG08	N/A	2.4	ct89379	View
7	Blueberry-W85-23-2017	LG08	N/A	0	ct89379	View
8	Cranberry-CNJ02-1-2017	LG08	N/A	1.5	ct89379	View
9	Cranberry-Crimson_Queen-2017	LG08	N/A	0	ct89379	View
10	Cranberry-Mullica_Queen-2017	LG08	N/A	0	ct89379	View
11	Cranberry-Composite_map-F1	LG08	N/A	84.69	ct89379	View
12	Cranberry-Crimson_Queen-F1	LG08	N/A	73.51	ct89379	View
13	Cranberry-GH1/35-F1	LG08	N/A	79.5	ct89379	View
14	Cranberry-Mullica_Queen_1-F1	LG08	N/A	110.28	ct89379	View