ct89711, ct89711 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect89711
Genbank IDKP279102
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)13
Primer 1ct89711.forward primer: CTCCACACCCACAATCTG
Primer 2ct89711.reverse primer: CGTCTTATTTTTAGTCACCTGG
Max Length149
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG03N/A14.3ct89711View
2Cranberry-Mullica_Queen-2017LG03N/A17.5ct89711View
3Cranberry-Mullica_Queen-2007LG3N/A26.5ct89711View
4Cranberry-CNJ02-1-2007LG3N/A22.42ct89711View
5Cranberry-CNJ02-1-2017LG03N/A15.8ct89711View
6Cranberry-Crimson_Queen-2007LG3N/A18.8ct89711View
7Cranberry-Composite_map-F1LG03N/A70.52ct89711View
8Cranberry-Crimson_Queen-F1LG03N/A69.35ct89711View
9Cranberry-Mullica_Queen_1-F1LG03N/A93.88ct89711View
10Cranberry-BB/CQ-F1LG07N/A20.85ct89711View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279102
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct89711.forward primerVaccinium macrocarponprimer
reverse primerct89711.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct89711ct89711Vaccinium macrocarponmarker_locus
ct89711ct89711-70.52Vaccinium macrocarponmarker_locus
ct89711ct89711-69.35Vaccinium macrocarponmarker_locus
ct89711ct89711-93.88Vaccinium macrocarponmarker_locus
ct89711ct89711-20.85Vaccinium macrocarponmarker_locus