ct92708, ct92708 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect92708
Genbank IDKP279103
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1ct92708.forward primer: CCCTAGATATTTCTGGAACACT
Primer 2ct92708.reverse primer: AAGATAGAGAGAGACAAAGGAGG
Max Length152
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG06N/A80.3ct92708View
2Cranberry-Mullica_Queen-2017LG06N/A92.8ct92708View
3Blueberry-F1#10-2017LG06N/A83.7ct92708View
4Cranberry-CNJ02-1-2007LG6N/A89.94ct92708View
5Cranberry-Crimson_Queen-2017LG06N/A67.1ct92708View
6Cranberry-Mullica_Queen-2007LG6N/A106ct92708View
7Cranberry-Crimson_Queen-2007LG6N/A77.9ct92708View
8Blueberry-W85-23-2017LG06N/A95ct92708View
9Blueberry-F1#10_x_W85-23-F1-2017LG06N/A71.9ct92708View
10Cranberry-Composite_map-F1LG06N/A11.05ct92708View
11Cranberry-Crimson_Queen-F1LG06N/A8.35ct92708View
12Cranberry-Mullica_Queen_1-F1LG06N/A10.75ct92708View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279103
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct92708.forward primerVaccinium macrocarponprimer
reverse primerct92708.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct92708ct92708Vaccinium macrocarponmarker_locus
ct92708ct92708-11.05Vaccinium macrocarponmarker_locus
ct92708ct92708-8.35Vaccinium macrocarponmarker_locus
ct92708ct92708-10.75Vaccinium macrocarponmarker_locus