Ig1296a, Ig1296a (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	Ig1296a
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	Ig1296a.forward primer: CCCCTGAATTCTTGTTCCAA
Primer 2	Ig1296a.reverse primer: GAGTGGAAAACGCAGTGGAT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr09	supercontig	Vmac_chr09:30040848..30041028 .
chr9	supercontig	chr9:11445366..11445552 .
Chr06	supercontig	Chr06:10937269..10937446 .
Chr06_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr06_Vaccinium_vitis-idaea_ssp_minus:11615422..11615593 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG9	N/A	58.99	Ig1296a	View
2	Cranberry-Crimson_Queen-2007	LG9	N/A	54.5	Ig1296a	View
3	Cranberry-Mullica_Queen-2007	LG9	N/A	71.3	Ig1296a	View
4	Cranberry-Unifiedmap2013	LG1	N/A	40.4	Ig1296a	View
5	Cranberry-CNJ02-1-2017	LG09	N/A	53	Ig1296a	View
6	Cranberry-Crimson_Queen-2017	LG09	N/A	46.4	Ig1296a	View
7	Cranberry-Mullica_Queen-2017	LG09	N/A	60.6	Ig1296a	View
8	Cranberry-Composite_map-F1	LG09	N/A	37.47	Ig1296a	View
9	Cranberry-Crimson_Queen-F1	LG09	N/A	24.49	Ig1296a	View
10	Cranberry-Mullica_Queen_1-F1	LG09	N/A	38.77	Ig1296a	View
11	Cranberry-BB/CQ-F1	LG01	N/A	42.06	Ig1296a	View
12	Cranberry-BB/CQ-F1	LG01	N/A	34.41	Ig1296a	View