Ig16780a, Ig16780a (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	Ig16780a
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	Ig16780a.forward primer: GTGAGGGGTGCCAAGTAGTC
Primer 2	Ig16780a.reverse primer: CCAAAATTGGTGACCCTTTC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr01	supercontig	Vmac_chr01:7222591..7222891 .
chr1	supercontig	chr1:41414183..41414485 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG1	N/A	122.9	Ig16780a	View
2	Cranberry-CNJ02-1-2007	LG1	N/A	99.75	Ig16780a	View
3	Cranberry-Crimson_Queen-2007	LG1	N/A	85.8	Ig16780a	View
4	Cranberry-Mullica_Queen-2007	LG1	N/A	110.9	Ig16780a	View
5	Cranberry-CNJ02-1-2017	LG01	N/A	93.9	Ig16780a	View
6	Cranberry-Crimson_Queen-2017	LG01	N/A	88.1	Ig16780a	View
7	Cranberry-Mullica_Queen-2017	LG01	N/A	99.1	Ig16780a	View