Ig51a, Ig51a (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	Ig51a
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	Ig51a.forward primer: TTGGTGCAAGATCACCACAT
Primer 2	Ig51a.reverse primer: GCACAAACGGATGTAGCAGA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr07	supercontig	Vmac_chr07:32780419..32780740 .
chr7	supercontig	chr7:31883487..31883798 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG7	N/A	9.43	Ig51a	View
2	Cranberry-Crimson_Queen-2007	LG7	N/A	9	Ig51a	View
3	Cranberry-Mullica_Queen-2007	LG7	N/A	10.3	Ig51a	View
4	Cranberry-Unifiedmap2013	LG3	N/A	9.3	Ig51a	View
5	Cranberry-CNJ02-1-2017	LG07	N/A	5.9	Ig51a	View
6	Cranberry-Crimson_Queen-2017	LG07	N/A	4.5	Ig51a	View
7	Cranberry-Mullica_Queen-2017	LG07	N/A	6.9	Ig51a	View
8	Cranberry-Composite_map-F1	LG07	N/A	85.62	Ig51a	View
9	Cranberry-Crimson_Queen-F1	LG07	N/A	81.03	Ig51a	View
10	Cranberry-Mullica_Queen_1-F1	LG07	N/A	99.29	Ig51a	View
11	Cranberry-BB/CQ-F1	LG03	N/A	88.08	Ig51a	View