Ig6523b, Ig6523b (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameIg6523b
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1Ig6523b.forward primer: CCATCTACCACGGCAGAGAT
Primer 2Ig6523b.reverse primer: GCATATTTTGGTTGGATCGG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG8N/A3.1Ig6523bView
2Cranberry-BB/CQ-F1LG04N/A0Ig6523bView
3Cranberry-CNJ02-1-2017LG08N/A3.1Ig6523bView
4Cranberry-Unifiedmap2013LG4N/A0Ig6523bView
5Cranberry-Crimson_Queen-2017LG08N/A0Ig6523bView
6Cranberry-Crimson_Queen-2007LG8N/A3.4Ig6523bView
7Cranberry-Mullica_Queen-2017LG08N/A3.2Ig6523bView
8Cranberry-CNJ02-1-2007LG8N/A2.98Ig6523bView
9Cranberry-Composite_map-F1LG08N/A84.69Ig6523bView
10Cranberry-Crimson_Queen-F1LG08N/A74.7Ig6523bView
11Cranberry-Mullica_Queen_1-F1LG08N/A111.47Ig6523bView
12Cranberry-BB/CQ-F1LG04N/A5.91Ig6523bView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerIg6523b.forward primerVaccinium macrocarponprimer
reverse primerIg6523b.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ig6523bIg6523bVaccinium macrocarponmarker_locus
Ig6523bIg6523b-84.69Vaccinium macrocarponmarker_locus
Ig6523bIg6523b-74.7Vaccinium macrocarponmarker_locus
Ig6523bIg6523b-111.47Vaccinium macrocarponmarker_locus
Ig6523bIg6523b-5.91Vaccinium macrocarponmarker_locus