Ig729b, Ig729b (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameIg729b
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1Ig729b.forward primer: GAAAGAAAGGTAAAGGGCCG
Primer 2Ig729b.reverse primer: ATCGAAGGCATTTCCATGAG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG4N/A86.8Ig729bView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerIg729b.forward primerVaccinium macrocarponprimer
reverse primerIg729b.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ig729bIg729bVaccinium macrocarponmarker_locus