Ig729b, Ig729b (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	Ig729b
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	Ig729b.forward primer: GAAAGAAAGGTAAAGGGCCG
Primer 2	Ig729b.reverse primer: ATCGAAGGCATTTCCATGAG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr10_H1	supercontig	chr10_H1:4358038..4358307 .
Vmac_chr08	supercontig	Vmac_chr08:3944797..3945068 .
chr8	supercontig	chr8:4118209..4118478 .
Chr10	supercontig	Chr10:31342879..31343139 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG4	N/A	86.8	Ig729b	View