NA1792, NA1792 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	NA1792
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	NA1792.forward primer: GCATCATCGCCGTCAAG
Primer 2	NA1792.reverse primer: TTGACTTCATCGAAAGCACG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00416	supercontig	scaffold00416:61754..61940 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG7	N/A	33.01	NA1792	View
2	Cranberry-Crimson_Queen-2007	LG7	N/A	31.6	NA1792	View
3	Cranberry-Mullica_Queen-2007	LG7	N/A	34.3	NA1792	View
4	Cranberry-Unifiedmap2013	LG3	N/A	29.6	NA1792	View
5	Cranberry-CNJ02-1-2017	LG07	N/A	27.2	NA1792	View
6	Cranberry-Crimson_Queen-2017	LG07	N/A	28.4	NA1792	View
7	Cranberry-Mullica_Queen-2017	LG07	N/A	27.1	NA1792	View
8	Cranberry-Composite_map-F1	LG07	N/A	64.37	NA1792	View
9	Cranberry-Crimson_Queen-F1	LG07	N/A	59.58	NA1792	View
10	Cranberry-Mullica_Queen_1-F1	LG07	N/A	75.73	NA1792	View
11	Cranberry-Mullica_Queen_2-F1	LG07	N/A	79.02	NA1792	View
12	Cranberry-Stevens-F1	LG07	N/A	52.57	NA1792	View
13	Cranberry-BB/CQ-F1	LG03	N/A	75.65	NA1792	View
14	Cranberry-BB/CQ-F1	LG03	N/A	71.7	NA1792	View