NA619, NA619 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	NA619
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	NA619.forward primer: TCACACTACAGGCAGGAGAGA
Primer 2	NA619.reverse primer: GAAGCCCCAGTTCTCACAAG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr06	supercontig	Vcev1_p0.Chr06:29926845..29926993 .
chr6_H1	supercontig	chr6_H1:24942036..24942180 .
Chr06	supercontig	Chr06:17880249..17880377 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG9	N/A	46.04	NA619	View
2	Cranberry-CNJ02-1-2007	LG9	N/A	38.35	NA619	View
3	Cranberry-Crimson_Queen-2007	LG9	N/A	37.4	NA619	View
4	Cranberry-Mullica_Queen-2007	LG9	N/A	44.7	NA619	View
5	Cranberry-Unifiedmap2013	LG1	N/A	68.3	NA619	View
6	Cranberry-CNJ02-1-2017	LG09	N/A	36.5	NA619	View
7	Cranberry-Crimson_Queen-2017	LG09	N/A	30.1	NA619	View
8	Cranberry-Mullica_Queen-2017	LG09	N/A	43.6	NA619	View
9	Cranberry-Composite_map-F1	LG09	N/A	59.09	NA619	View
10	Cranberry-Crimson_Queen-F1	LG09	N/A	41.17	NA619	View
11	Cranberry-Mullica_Queen_1-F1	LG09	N/A	65.59	NA619	View