scf191a, scf191a (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf191a
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf191a.forward primer: TCTCTTCCTCCACTTTCCCC
Primer 2scf191a.reverse primer: CAACTTGCACTGCTACCCAA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A0.9scf191aViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf191a.forward primerVaccinium macrocarponprimer
reverse primerscf191a.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf191ascf191aVaccinium macrocarponmarker_locus