SCF102538, SCF102538 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF102538
Genbank IDKP279056
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)12
Primer 1SCF102538.forward primer: TTACTGGGCAATAGAAGGACT
Primer 2SCF102538.reverse primer: CACATAAGTTTGGCTACACAAC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG08N/A71.8SCF102538View
2Cranberry-Crimson_Queen-F1LG08N/A0SCF102538View
3Cranberry-Mullica_Queen-2017LG08N/A99.8SCF102538View
4Cranberry-Crimson_Queen-2007LG8N/A76.5SCF102538View
5Cranberry-Mullica_Queen-2007LG8N/A107.2SCF102538View
6Cranberry-CNJ02-1-2017LG08N/A86.8SCF102538View
7Cranberry-CNJ02-1-2007LG8N/A90.31SCF102538View
8Cranberry-Mullica_Queen_1-F1LG08N/A2.38SCF102538View
9Cranberry-Composite_map-F1LG08N/A2.38SCF102538View
10Cranberry-Mullica_Queen_2-F1LG08N/A9.01SCF102538View
11Cranberry-Stevens-F1LG08N/A1.49SCF102538View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279056
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF102538.forward primerVaccinium macrocarponprimer
reverse primerSCF102538.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF102538SCF102538Vaccinium macrocarponmarker_locus
SCF102538SCF102538-2.38Vaccinium macrocarponmarker_locus
SCF102538SCF102538-9.01Vaccinium macrocarponmarker_locus
SCF102538SCF102538-1.49Vaccinium macrocarponmarker_locus