SCF102538, SCF102538 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF102538
Genbank ID	KP279056
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)12
Primer 1	SCF102538.forward primer: TTACTGGGCAATAGAAGGACT
Primer 2	SCF102538.reverse primer: CACATAAGTTTGGCTACACAAC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279056

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:3219115..3219335 .
chr8	supercontig	chr8:3435956..3436178 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG8	N/A	90.31	SCF102538	View
2	Cranberry-Crimson_Queen-2007	LG8	N/A	76.5	SCF102538	View
3	Cranberry-Mullica_Queen-2007	LG8	N/A	107.2	SCF102538	View
4	Cranberry-Crimson_Queen-F1	LG08	N/A	0	SCF102538	View
5	Cranberry-CNJ02-1-2017	LG08	N/A	86.8	SCF102538	View
6	Cranberry-Crimson_Queen-2017	LG08	N/A	71.8	SCF102538	View
7	Cranberry-Mullica_Queen-2017	LG08	N/A	99.8	SCF102538	View
8	Cranberry-Composite_map-F1	LG08	N/A	2.38	SCF102538	View
9	Cranberry-Mullica_Queen_1-F1	LG08	N/A	2.38	SCF102538	View
10	Cranberry-Mullica_Queen_2-F1	LG08	N/A	9.01	SCF102538	View
11	Cranberry-Stevens-F1	LG08	N/A	1.49	SCF102538	View