SCAR2122, SCAR2122 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCAR2122
Genbank ID	N/A
Type	SCAR
Species	Vaccinium macrocarpon
Primer 1	SCAR2122.forward primer: CAATCGCCGTATCGGTTAGAG
Primer 2	SCAR2122.reverse primer: CAATCGCCGTCAATTTCTCAG
Publication	[view all]

Publications


Year	Publication
2002	Polashock J, Vorsa N. Development of SCAR markers for DNA fingerprinting and germplasm analysis of American cranberry. Journal of the American Society for Horticultural Science. 2002 July; 127(4):677-684.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG7a	N/A	30.5	SCAR2122	View