SCAR5657, SCAR5657 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCAR5657
Genbank ID	N/A
Type	SCAR
Species	Vaccinium macrocarpon
Primer 1	SCAR5657.forward primer: GAATGGTGAGATTCAGAACTTGTG
Primer 2	SCAR5657.reverse primer: GAATGGTGAGCATAATGAGTCCTG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr4	supercontig	chr4:13912392..13912981 .

Publications


Year	Publication
2002	Polashock J, Vorsa N. Development of SCAR markers for DNA fingerprinting and germplasm analysis of American cranberry. Journal of the American Society for Horticultural Science. 2002 July; 127(4):677-684.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG2	N/A	51.4	SCAR5657	View