SCF1047, SCF1047 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF1047
Genbank ID	KP278596
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AC)10
Primer 1	SCF1047.forward primer: GAGCTTTGGCCTCATATTACT
Primer 2	SCF1047.reverse primer: CGAATTACTCCAACCAACAT
Max Length	267
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278596

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr11	supercontig	Vmac_chr11:34169569..34169810 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG11	N/A	70.21	SCF1047	View
2	Cranberry-Crimson_Queen-2007	LG11	N/A	63.9	SCF1047	View
3	Cranberry-CNJ02-1-2017	LG11	N/A	63.4	SCF1047	View
4	Cranberry-Crimson_Queen-2017	LG11	N/A	54.3	SCF1047	View
5	Cranberry-Composite_map-F1	LG11	N/A	72.22	SCF1047	View
6	Cranberry-Crimson_Queen-F1	LG11	N/A	67.5	SCF1047	View
7	Cranberry-BB/CQ-F1	LG11	N/A	69.76	SCF1047	View