SCF102190, SCF102190 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF102190
Genbank IDKP279054
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)11
Primer 1SCF102190.forward primer: GAGGAAAGGGTGAGAGTTTT
Primer 2SCF102190.reverse primer: GTTTGACGAAAAGGAGACTG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG12N/A86.61SCF102190View
2Cranberry-Stevens-F1LG12N/A69.18SCF102190View
3Blueberry-W85-23-2017LG12N/A0SCF102190View
4Blueberry-F1#10-2017LG12N/A0SCF102190View
5Blueberry-F1#10_x_W85-23-F1-2017LG12N/A2.7SCF102190View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279054
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF102190.forward primerVaccinium macrocarponprimer
reverse primerSCF102190.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF102190SCF102190-86.61Vaccinium macrocarponmarker_locus
SCF102190SCF102190-69.18Vaccinium macrocarponmarker_locus
SCF102190SCF102190Vaccinium macrocarponmarker_locus