SCF102347, SCF102347 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF102347
Genbank IDKP278808
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)12
Primer 1SCF102347.forward primer: GGTAGTGAGCAACGACATAAC
Primer 2SCF102347.reverse primer: CCTGAAGGTAAAGAAAGTAGCA
Max Length349
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG01N/A49.9SCF102347View
2Cranberry-Crimson_Queen-2017LG01N/A43.9SCF102347View
3Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG1N/A58.07SCF102347View
4Cranberry-[BG//BL/BN]95-F1LG01N/A70.02SCF102347View
5Cranberry-Composite_map-F1LG01N/A64.25SCF102347View
6Cranberry-Crimson_Queen-F1LG01N/A35.75SCF102347View
7Cranberry-GH1/35-F1LG01N/A63.63SCF102347View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278808
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF102347.forward primerVaccinium macrocarponprimer
reverse primerSCF102347.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF102347SCF102347Vaccinium macrocarponmarker_locus
SCF102347SCF102347-70.02Vaccinium macrocarponmarker_locus
SCF102347SCF102347-64.25Vaccinium macrocarponmarker_locus
SCF102347SCF102347-35.75Vaccinium macrocarponmarker_locus
SCF102347SCF102347-63.63Vaccinium macrocarponmarker_locus