SCF109269, SCF109269 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF109269
Genbank IDKP278820
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)11
Primer 1SCF109269.forward primer: CACTCCTTCCTTATAGATCAGC
Primer 2SCF109269.reverse primer: AAGTAGAAGAGCAGCACAAGAG
Max Length268
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG6N/A84.3SCF109269View
2Cranberry-Crimson_Queen-2017LG06N/A78.7SCF109269View
3Cranberry-CNJ02-1-2017LG06N/A90.6SCF109269View
4Cranberry-Mullica_Queen-2017LG06N/A102.4SCF109269View
5Cranberry-Mullica_Queen-2007LG6N/A115.7SCF109269View
6Blueberry-F1#10-2017LG06N/A94.6SCF109269View
7Blueberry-W85-23-2017LG06N/A107.8SCF109269View
8Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG6N/A3.34SCF109269View
9Blueberry-F1#10_x_W85-23-F1-2017LG06N/A83.1SCF109269View
10Cranberry-CNJ02-1-2007LG6N/A98.19SCF109269View
11Cranberry-[BG//BL/BN]95-F1LG06N/A3.41SCF109269View
12Cranberry-Composite_map-F1LG06N/A2.19SCF109269View
13Cranberry-Crimson_Queen-F1LG06N/A1.19SCF109269View
14Cranberry-GH1/35-F1LG06N/A1.71SCF109269View
15Cranberry-Mullica_Queen_1-F1LG06N/A1.79SCF109269View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278820
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF109269.forward primerVaccinium macrocarponprimer
reverse primerSCF109269.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit projected areaqFPA.GRYG.LG06.14Vaccinium macrocarponQTL
Fruit lengthqFLEN.GRYG.LG06.14Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF109269SCF109269Vaccinium macrocarponmarker_locus
SCF109269SCF109269-3.41Vaccinium macrocarponmarker_locus
SCF109269SCF109269-2.19Vaccinium macrocarponmarker_locus
SCF109269SCF109269-1.19Vaccinium macrocarponmarker_locus
SCF109269SCF109269-1.71Vaccinium macrocarponmarker_locus
SCF109269SCF109269-1.79Vaccinium macrocarponmarker_locus