scf105g, scf105g (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf105g
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf105g.forward primer: TCTGTACCTCCCCATTCCTG
Primer 2scf105g.reverse primer: CCAAACACGCCGTTAATCTT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG2N/A4.4scf105gViewN/A
2Cranberry-Stevens-F1LG04N/A0scf105gViewN/A
3Cranberry-BB/CQ-F1LG02N/A0scf105gViewN/A
4Cranberry-Composite_map-F1LG04N/A2.39scf105gViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf105g.forward primerVaccinium macrocarponprimer
reverse primerscf105g.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit color intensityqFCI.CNJ04-2.LG04Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf105gscf105gVaccinium macrocarponmarker_locus
scf105gscf105g-2.39Vaccinium macrocarponmarker_locus