scf10688, scf10688 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf10688
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf10688.forward primer: TCACTTTTCTTTCATGCCCC
Primer 2scf10688.reverse primer: GTGCTCCCACTAGCCCATAA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG3N/A36.8scf10688View
2Cranberry-Crimson_Queen-2017LG03N/A22.6scf10688View
3Cranberry-Crimson_Queen-2007LG3N/A26.6scf10688View
4Blueberry-F1#10-2017LG03N/A36.3scf10688View
5Cranberry-Unifiedmap2013LG7aN/A22.7scf10688View
6Cranberry-CNJ02-1-2007LG3N/A31.21scf10688View
7Blueberry-F1#10_x_W85-23-F1-2017LG03N/A38.2scf10688View
8Cranberry-CNJ02-1-2017LG03N/A25.9scf10688View
9Cranberry-Mullica_Queen-2017LG03N/A29.6scf10688View
10Cranberry-Composite_map-F1LG03N/A60.96scf10688View
11Cranberry-Crimson_Queen-F1LG03N/A59.22scf10688View
12Cranberry-Mullica_Queen_1-F1LG03N/A78.09scf10688View
13Cranberry-Stevens-F1LG03N/A46.41scf10688View
14Cranberry-BB/CQ-F1LG07N/A35.92scf10688View
15Cranberry-BB/CQ-F1LG07N/A25.27scf10688View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf10688.forward primerVaccinium macrocarponprimer
reverse primerscf10688.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf10688scf10688Vaccinium macrocarponmarker_locus
scf10688scf10688-60.96Vaccinium macrocarponmarker_locus
scf10688scf10688-59.22Vaccinium macrocarponmarker_locus
scf10688scf10688-78.09Vaccinium macrocarponmarker_locus
scf10688scf10688-46.41Vaccinium macrocarponmarker_locus
scf10688scf10688-35.924Vaccinium macrocarponmarker_locus
scf10688scf10688-25.271Vaccinium macrocarponmarker_locus