SCF111370, SCF111370 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF111370
Genbank IDKP278828
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)14
Primer 1SCF111370.forward primer: ACCACATCTTCATTTTGAGC
Primer 2SCF111370.reverse primer: GTAAAACAATACGGGTCCTTAC
Max Length284
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A77.97SCF111370ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A63.3SCF111370ViewN/A
3Cranberry-Mullica_Queen-2007LG1N/A89.2SCF111370ViewN/A
4Cranberry-CNJ02-1-2017LG01N/A73.5SCF111370ViewN/A
5Cranberry-Crimson_Queen-2007LG1N/A66.9SCF111370ViewN/A
6Cranberry-Mullica_Queen-2017LG01N/A85.3SCF111370ViewN/A
7Cranberry-Composite_map-F1LG01N/A31.68SCF111370ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A13.11SCF111370ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A13.71SCF111370ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278828
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF111370.forward primerVaccinium macrocarponprimer
reverse primerSCF111370.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF111370SCF111370Vaccinium macrocarponmarker_locus
SCF111370SCF111370-31.68Vaccinium macrocarponmarker_locus
SCF111370SCF111370-13.11Vaccinium macrocarponmarker_locus
SCF111370SCF111370-13.71Vaccinium macrocarponmarker_locus