SCF111370, SCF111370 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278828
SpeciesVaccinium macrocarpon
Repeat Motif(AC)14
Primer 1SCF111370.forward primer: ACCACATCTTCATTTTGAGC
Primer 2SCF111370.reverse primer: GTAAAACAATACGGGTCCTTAC
Max Length284
Publication[view all]
External references for this genetic_marker
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer