SCF11186, SCF11186 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF11186
Genbank IDKP278636
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TCC)9
Primer 1SCF11186.forward primer: AGAAAGGCTAAAAGGGTATCTC
Primer 2SCF11186.reverse primer: GCTCTCAACAACTCGAAAGTA
Max Length287
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG01N/A29.7SCF11186ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A26.3SCF11186ViewN/A
3Blueberry-F1#10_x_W85-23-F1-2017LG01N/A23.6SCF11186ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A31.43SCF11186ViewN/A
5Blueberry-F1#10-2017LG01N/A27.9SCF11186ViewN/A
6Cranberry-Crimson_Queen-2007LG1N/A27.2SCF11186ViewN/A
7Blueberry-W85-23-2017LG01N/A19.5SCF11186ViewN/A
8Cranberry-Composite_map-F1LG01N/A85.23SCF11186ViewN/A
9Cranberry-Crimson_Queen-F1LG01N/A54.23SCF11186ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278636
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF11186.forward primerVaccinium macrocarponprimer
reverse primerSCF11186.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF11186SCF11186Vaccinium macrocarponmarker_locus
SCF11186SCF11186-85.23Vaccinium macrocarponmarker_locus
SCF11186SCF11186-54.23Vaccinium macrocarponmarker_locus