SCF1128, SCF1128 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF1128
Genbank IDKP278597
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)13
Primer 1SCF1128.forward primer: GTTTGTTGTTGTGGTGGTTT
Primer 2SCF1128.reverse primer: CCTTACTTGACGCTTACTTCAG
Max Length322
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG4N/A77SCF1128View
2Cranberry-CNJ02-1-2017LG04N/A93.8SCF1128View
3Cranberry-Mullica_Queen-2017LG04N/A101.1SCF1128View
4Cranberry-Mullica_Queen-2007LG4N/A94.7SCF1128View
5Cranberry-CNJ02-1-2007LG4N/A88.69SCF1128View
6Cranberry-Crimson_Queen-2017LG04N/A56.2SCF1128View
7Cranberry-Composite_map-F1LG04N/A77.19SCF1128View
8Cranberry-Crimson_Queen-F1LG04N/A73.26SCF1128View
9Cranberry-Mullica_Queen_1-F1LG04N/A104.8SCF1128View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278597
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF1128.forward primerVaccinium macrocarponprimer
reverse primerSCF1128.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF1128SCF1128Vaccinium macrocarponmarker_locus
SCF1128SCF1128-77.19Vaccinium macrocarponmarker_locus
SCF1128SCF1128-73.26Vaccinium macrocarponmarker_locus
SCF1128SCF1128-104.8Vaccinium macrocarponmarker_locus